Case Reports t1117q23p13ChakerID100096

Home   Genes   Leukemias   Solid Tumors   Cancer-Prone   Deep Insight   Case Reports   Journals   Portal   Teaching   
X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA

do you wish to send a case report ?

General Information

(Paper co-edited with the European LeukemiaNet)
A first case of adult secondary acute myeloid leukemia with the recurrent KMT2A-GAS7 fusion
Written2018-04Hend Chaker, Josée Hébert
Quebec Leukemia Cell Bank, Hôpital Maisonneuve-Rosemont, Montréal, Canada. Department of Medicine, Université de Montréal, Montréal, Canada.
Age and sex : 71 year(s) old male patient.
Previous History : preleukemia (Chronic myeloproliferative neoplasm : Primary myelofibrosis was diagnosed in 2005. The patient was treated with Hydroxyurea from January 2005 to March 2007.)
no previous malignant disease
no inborn condition of note
Organomegaly : hepatomegaly ; splenomegaly ; no enlarged lymph nodes ; no central nervous system involvement
WBC : 32.4 x 109/L ; Hb : Not g/dL (available); platelets : Not available x 109/L; blasts : 70 % .
Bone marrow : Not performed
Cyto pathology classification
Phenotype : Acute myeloid leukaemia, not otherwise specified (WHO 2008).
Immunophenotype : HLADR: 20%, CD117: 93%, CD34: 10%, CD33: 50%, CD13: 95%, CD36: 30%, CD56: 13%, CD14: 6%, CD15: 7%, CD7: 21%, CD3: 2%, CD10: 3%, CD19: 0%, CD20: 6%.
Date of diagnosis: 12-2006
Treatment : Palliative care: treatment with Hydroxyurea
Complete remission : None
Treatment related death : -
Status : Dead 03-2007
Survival : 3 month(s)
Sample : Blood ; culture time : 24-48 h, (unstimulated 24h and 48h cultures) ; banding : GTG
Results : 46,XY,t(11;17)(q23;p13)[21]
Other molecular cytogenetics technics : FISH (Fluorescent In Situ Hybridization); VYSIS LSI MLL Dual-color, Break-apart rearrangement probe (Abbott Molecular Inc., Des Plaines, IL). BAC (Bacterial artificial chromosome) probe RP11-952P13 covering the GAS7 gene (
Other molecular cytogenetics results : FISH experiments were performed on metaphasic and interphasic cells with the commercial MLL probe. Analysis showed a KMT2A/MLL rearrangement in 98% of 200 interphasic nuclei and confirmed the t(11;17) translocation (Figure 2A).
FISH analysis with the RP11-952P13 BAC probe revealed a GAS7 rearrangement. Hybridization signals on metaphasic chromosomes were detected on normal chromosome 17 and on derivative chromosomes 11 and 17 (Figure 2B).
Other molecular studies
technics : RNA extraction, RT-PCR and standard sequencing
-KMT2A forward primer: 5'ACCACTCCTAGTGAGCCCAAGAAA 3' located in KMT2A exon 7
-GAS7 reverse primer: 3'TGGTCTCATTGGTGGTCGTGTTGA5' located in GAS7 exon 2-3.
results : Two KMT2A-GAS7 fusion transcripts were detected (Figure 3A). Sequence analysis of these transcripts revealed an in-frame fusion between KMT2A exon 8 and GAS7 exon 2 for the predominant transcript (transcript 1), and KMT2A exon 7 and GAS7 exon 2 for the second transcript (transcript 2) (Figure 3B).
Other findings
results : The t(11;17)(q23;p13) translocation generates a KMT2A/MLL-GAS7 in-frame fusion transcript which encodes a putative chimeric protein. The N-terminal region of the KMT2A protein including the AT-hooks, speckled nuclear localization signals 1 and 2 motifs, and DNA methyltransferase domains, is fused to almost the entire GAS7 protein, containing WW domain and F-bar dimerization module with a FER-CIP4 Homology (FCH) domain and a coiled coil region domain (Figure 4). The predicted GAS7 domains are based on NCBI search for conserved domains within coding nucleotide sequences. (
Figure 1. GTG-banded Karyotype. GTG-banded karyotype of leukemic cells showing the t(11;17)(q23;p13) translocation. Arrows indicate the derivative chromosomes der(11) and der(17).
Figure. 2. Fluorescence in situ hybridization (FISH) analysis of the t(11;17) positive cells. (A) FISH with the LSI MLL dual-color, break-apart rearrangement probe showing the MLL rearrangement. The fusion signal is located on the normal chromosome 11, the green signal, centromeric part of the probe, is detected on the derivative chromosome der(11) and the red signal, telomeric part of the probe, is detected on the derivative chromosome der(17). (B) FISH with RP11-952P13 probe showing rearrangement of GAS7. A normal signal is detected on chromosome 17, and a split signal is visualized on both derivative chromosomes der(17) and der(11).
Figure. 3. Analysis of the KMT2A-GAS7 transcripts. (A) PCR products obtained by Reverse-Transcriptase Polymerase Chain Reaction (RT-PCR). M, 1Kb DNA marker; lane 1, KMT2A/MLL-GAS7 cDNA fragments generated by KMT2A-FW-exon7 and GAS7-RV-exon2-3 primers. Arrows indicate the two 300bp and 220bp amplified KMT2A-GAS7 transcripts. (B) Chromatogram showing partial nucleotide sequences of the two KMT2A-GAS7 transcripts. The arrows indicate the breakpoints of the KMT2A/MLL-GAS7 fusion.
Figure 4. Schematic representation of KMT2A, GAS7 and the predicted KMT2A-GAS7 fusion proteins. The predicted KMT2A-GAS7 chimeric protein contains AT-Hook domains (ATH1-3), speckled nuclear localization1,2 (SNL1,2) and DNA methyltransferase (MT) domains followed by full-length GAS7 containing WW domain and F-bar dimerization module with FCH domain and Coiled coil region. Abbreviations: SET (Su(var)3-9, Enhancer-of-zeste, Trithorax) domain with histone H3K4 methyltransferase activity, FCH: FER-CIP4 Homology.
This case represents the first case of adult leukemia associated to the KMT2A-GAS7 fusion. GAS7 is a rare recurrent fusion partner of KMT2A. To our knowledge, only two cases with this fusion have been reported in the literature, in pediatric and infant leukemias. The first case was identified in a 14-year-old boy with a therapy-related AML, after DNA topoisomerase II inhibitor treatment for a neuroblastoma. The patient died 4 months after diagnosis (Megonigal MD et al, 2000). The second case was identified in a 15-month-old girl with a de novo B-cell acute lymphoblastic leukemia. This patient was in remission 14 months after diagnosis (Panagopoulos I et al, 2006). Additionally, the translocation t(11;17)(q23;p13) was reported, without molecular characterization, in few studies (Chessells JM et al, 2002 and Stark B et al, 1989).
The adult patient described here was treated with a palliative approach because of comorbidities and he died 3 months after the diagnosis of AML. This specimen was sequenced (RNA sequencing) as part of the Leucegene project (Nature Genet 2015).
Internal links
Atlas Cardt(11;17)(q23;p13) KMT2A/GAS7
Clinical features, cytogenetics and outcome in acute lymphoblastic and myeloid leukaemia of infancy: report from the MRC Childhood Leukaemia working party
Chessells JM, Harrison CJ, Kempski H, Webb DK, Wheatley K, Hann IM, Stevens RF, Harrison G, Gibson BE; MRC Childhood Leukaemia working party
Leukemia 2002 May;16(5):776-84
PMID 11986937
The transcriptomic landscape and directed chemical interrogation of MLL-rearranged acute myeloid leukemias
Lavallée VP, Baccelli I, Krosl J, Wilhelm B, Barabé F, Gendron P, Boucher G, Lemieux S, Marinier A, Meloche S, Hébert J, Sauvageau G
Nat Genet 2015 Sep;47(9):1030-7
PMID 26237430
Detection of leukemia-associated MLL-GAS7 translocation early during chemotherapy with DNA topoisomerase II inhibitors
Megonigal MD, Cheung NK, Rappaport EF, Nowell PC, Wilson RB, Jones DH, Addya K, Leonard DG, Kushner BH, Williams TM, Lange BJ, Felix CA
Proc Natl Acad Sci U S A 2000 Mar 14;97(6):2814-9
PMID 10706619
MLL/GAS7 fusion in a pediatric case of t(11;17)(q23;p13)-positive precursor B-cell acute lymphoblastic leukemia
Panagopoulos I, Lilljebjörn H, Strömbeck B, Hjorth L, Olofsson T, Johansson B
Haematologica 2006 Sep;91(9):1287-8
PMID 16956839
Biologic and cytogenetic characteristics of leukemia in infants
Stark B, Vogel R, Cohen IJ, Umiel T, Mammon Z, Rechavi G, Kaplinsky C, Potaznik D, Dvir A, Yaniv Y, et al
Cancer 1989 Jan 1;63(1):117-25
PMID 2910409

1. Citation

This paper should be referenced as such : D>
Chaker H, Hébert J
A first case of adult secondary acute myeloid leukemia with the recurrent KMT2A-GAS7 fusion
Atlas Genet Cytogenet Oncol Haematol. in press
On line version :

© Atlas of Genetics and Cytogenetics in Oncology and Haematology
indexed on : Wed Nov 28 17:10:12 CET 2018

Home   Genes   Leukemias   Solid Tumors   Cancer-Prone   Deep Insight   Case Reports   Journals   Portal   Teaching   

For comments and suggestions or contributions, please contact us